Philosophers, historians, ethicists, and theologians provide the perspectives of their fields on astrobiology for graduate students and researchers.

This book addresses important current and historical topics in astrobiology and the search for life beyond Earth, including the search for extraterrestrial intelligence (SETI). The first section covers the plurality of worlds debate from antiquity through the nineteenth century, while section two covers the extraterrestrial life debate from the twentieth century to the present. The final section examines the societal impact of discovering life beyond Earth, including both cultural and religious dimensions. Throughout the book, authors draw links between their own chapters and those of other contributors, emphasizing the interconnections between the various strands of the history and societal impact of the search for extraterrestrial life. The chapters are all written by internationally recognized experts and are carefully edited by Douglas Vakoch, professor of clinical psychology at the California Institute of Integral Studies and Director of Interstellar Message Composition at the SETI Institute. This interdisciplinary book will benefit everybody trying to understand the meaning of astrobiology and SETI for our human society.

ASTROBIOLOGY This unique book advances the frontier discussion of a wide spectrum of astrobiological issues on scientific advances, space ethics, social impact, religious meaning, and public policy formulation. Astrobiology is an exploding discipline in which not only the natural sciences, but also the social sciences and humanities converge. Astrobiology: Science, Ethics, and Public Policy is a multidisciplinary book that presents different perspectives and points of view by its contributing specialists. Epistemological, moral and political issues arising from astrobiology, convey the complexity of challenges posed by the search for life elsewhere in the universe. We ask: if a convoy of colonists from Earth make the trip to Mars, should their genomes be edited to adapt to the Red Planet’s environment? If scientists discover a biosphere with microbial life within our solar system, will it possess intrinsic value or merely utilitarian value? If astronomers discover an intelligent civilization on an exoplanet elsewhere in the Milky Way, what would be humanity’s moral responsibility: to protect Earth from an existential threat? To treat other intelligences with dignity? To exploit through interstellar commerce? To conquer? Audience The book will attract readers from a wide range of interests including astronomers, astrobiologists, chemists, biologists, space engineers, ethicists, theologians and philosophers.

'You will not find a better, more balanced or up-to-date take on either the origin of life or synthetic biology. Essential reading' Observer Creation by Adam Rutherford tells the entire spellbinding story of life in two gripping narratives. 'Prepare to be astounded. There are moments when this book is so gripping it reads like a thriller' Mail on Sunday The Origin of Life is a four-billion-year detective story that uses the latest science to explain what life is and where it first came from, dealing with life's biggest questions and arriving at a thrilling answer. 'A superbly written explanation' Brian Cox The Future of Life introduces an extraordinary technological revolution: 'synthetic biology', the ability to create entirely new life forms within the lab. Adam Rutherford explains how this remarkable innovation works and presents a powerful argument for its benefit to humankind. 'The reader's sense of awe at the well-nigh inconceivable nature of nature is suitably awakened. The extraordinary science and Rutherford's argument are worth every reader's scrutiny. Fascinating' Sunday Telegraph 'One of the most eloquent and genuinely thoughtful books on science over the past decade. You will not find a better, more balanced or up-to-date take on the origin of life or synthetic biology. Essential reading for anyone interested in the coming revolution, which could indeed rival the Industrial Revolution or the internet' Observer 'The perfect primer on the past and future of DNA' Guardian 'Susenseful, erudite and thrilling' Prospect 'A witty, engaging and eye-opening explanation of the basic units of life, right back to our common ancestors and on to their incredible synthetic future. The mark of a really good science book, it shows that the questions we still have are just as exciting as the answers we already know' Dara O Briain 'This is a quite delightful two-books-in-one. Rutherford's lightness of touch in describing the dizzying complexity of life at the cellular level in The Origin of Life only serves to emphasise the sheer scale and ambition of the emerging field of synthetic biology' Jim Al Khalili 'A fascinating glimpse into our past and future. Rutherford's illuminating book is full of optimism about what we might be able to achieve' Sunday Times 'Fresh, original and excellent. An eye-opening look at how we are modifying and constructing life. Totally fascinating' PopularScience.co.uk 'In this book of two halves, Rutherford tells the epic history of life on earth, and eloquently argues the case for embracing technology which allows us to become biological designers' Alice Roberts 'An engaging account of both the mystery of life's origin and its impending resolution as well as a fascinating glimpse of the impending birth of a new, synthetic biology'' Matt Ridley, author of Genome 'I warmly recommend Creation. Rutherford's academic background in genetics gives him a firm grasp of the intricacies of biochemistry - and he translates these superbly into clear English' Financial Times Dr Adam Rutherford is a geneticist, writer and broadcaster. He presents BBC Radio 4's weekly programme Inside Science and his documentaries include the award-winning series The Cell (BBC4), The Gene Code (BBC4), Horizon: 'Playing God' (BBC2) as well as numerous other programmes for BBC Radio 4. This is his first book. TGTCGTGAAGCTACTATTTAAAATGCCACAGTGAAAGATTAAACGCCCGAAAACGGGGTGATAAATGGACGGTAAGTTCCCGACTAAACGTGTTAAATG

We live in an evolving and increasingly complex global community and with this complexity comes a broad range of ethical issues. The Ethics: Contemporary Perspectives brings together scholars from across the humanities, social sciences, and sciences, including disciplines as diverse as philosophy, law, medicine and the study of world religions, to discuss these broad ethical issues in contemporary society. Its aim is explore our complex world, addressing both old and new ethical issues through scholarly discourse. This collection of essays looks at Extraterrestrial life. It looks at as a discipline itself and also the religious questions that arise in the investigation of the topic. It also looks at the topic of astrobiology and space exploration. The contributors are Christian theologians, ethicists as well as those who study and work at the International Space University based in France but with links around the world.

Human beings have wondered about the stars since the dawn of the species. Does life exist out there – intelligent life, even – or are we alone? The quest for life in the universe touches on fundamental hopes and fears. It touches on the essence of what it means to formulate a theory, grasp a concept, and have an imagination. This book traces the history of the science of this area and the development of new schools in philosophy. Its essays seek to establish the history and philosophy of astrobiology as research fields in their own right by addressing cognitive, linguistic, epistemological, ethical, cultural, societal, and historical perspectives on astrobiology. The book is divided into three sections. The first (Cognition) focuses on the human mind and what it contributes to the search for life. It explores the emergence and evolution of terrestrial life and cognition and the challenges humans face as they reach to the stars. The essays raise philosophical questions, pose ethical dilemmas, and offer a variety of approaches, including one from cognitive zoology, in formulating a theory of the universal principles of intelligence, the limits of human conceptual abilities, and the human mind’s encounter with the unknown. The second section (Communication) examines the linguistic and semiotic requirements for interstellar communication. What is needed for successful communication? Are there universal rules for success? What are the possible features – and limitations – of exolanguages? What is required for recognizing a message as a message? The third section (Culture) considers cultural and societal issues. It explores astrobiology’s organization as a scientific discipline, its responsibilities to the public sphere, and its theological implications. It reviews the historically important panspermia hypothesis, along with the popularization of astrobiology and its ongoing institutionalisation. Through addressing these questions, we take our first steps in exploring the immense terra incognita of extraterrestrial life and the human mind.